Abby is a 6-year-old girl with a severe yet undiagnosed disease. Abby and both parents have had their genomes sequenced. They need your help.
#13 by Colby MD
Sat May 07, 2016 12:10 am
Details for the likely pathogenic variant that is the cause of Abbie's illness are provided below.

This variant was identified by Dr. Wendy Chung of Columbia University in New York. Dr. Chung has also identified several other children with variants in the HNRNPH2 - these children have phenotypes very similar to Abbie. Dr. Chung is currently researching the molecular impact of variants in the HNRNPH2 gene and is seeking other children that may have mutations in this gene.

* If you are a researcher or healthcare provider and have a patient with a possible mutation in the HNRNPH2 gene, please contact Dr. Chung by emailing [email protected] with subject "Email for Dr. Chung - HNRNPH2". We will then put you in contact wtih Dr. Chung.

* If you are a parent of a child with a possible mutation in the HNRNPH2 gene, a support group is being formed so that you can communicate with other parents, healthcare providers and researchers. To join this support group, please contact Dr. Brandon Colby by emailing [email protected] with subject "Email for Dr. Colby - HNRNPH2"

PATHOGENIC VARIANT DETECTED
Gene: HNRNPH2
Chr: X
Coordinate (hg19): 100667602
Variant: 626C>T
Amino Acid Codon: 209
Coding change: P209L
Sequence: GAAAGCTCATGGCTATGCAGCGGCCAGGTC(C>T)CTATGATAGGCCGGGGGCTGGCAGAGGGTA

Additional information:
chrX:100667602
X:100667602
Heterogeneous Nuclear Ribonucleoprotein H2 (H')
hg38: 101412614
chrX:101412614
X:101412614
Pro209Leu
Proline 209 Leucine
HNRPH2
NCBI Reference Sequence: NM_001032393.2
https://www.ncbi.nlm.nih.gov/nuccore/NM_001032393
http://www.omim.org/entry/300610

Excellent work by Dr. Chung and her team at Columbia University!
#14 by Colby MD
Fri Jun 10, 2016 10:36 pm
Pathogenic variants in the HNRNPH2 gene have been identified in a small group of children. These children have shared, but variable, medical and developmental histories which include:

seizures
deve lopmental delays
autism spectrum disorders
anxiety
low muscle tone
microcephaly (small head size)
ataxia
similar facial features

* To contact the lead investigator, Dr. Wendy Chung of Columbia University in New York, please email [email protected] with subject "Email for Dr. Chung - HNRNPH2". We will then put you in contact with Dr. Chung.

Who is online

Users browsing this forum: No registered users and 1 guest